Skip to Main Content (Press Enter)

Logo UNIMI
  • ×
  • Home
  • Persone
  • Attività
  • Ambiti
  • Strutture
  • Pubblicazioni
  • Terza Missione

Expertise & Skills
Logo UNIMI

|

Expertise & Skills

unimi.it
  • ×
  • Home
  • Persone
  • Attività
  • Ambiti
  • Strutture
  • Pubblicazioni
  • Terza Missione
  1. Pubblicazioni

Development of an ESI-MS method for DNA-ligand screening applied to recognition of T:G mismatched base pairs

Altro Prodotto di Ricerca
Data di Pubblicazione:
2008
Citazione:
Development of an ESI-MS method for DNA-ligand screening applied to recognition of T:G mismatched base pairs / F. Riccardi Sirtori, R. D’Alessio, G. Aldini, M. Colombo. ((Intervento presentato al 56. convegno ASMS Conference on Mass Spectrometry and Applied Topics tenutosi a Denver nel 2008.
Abstract:
Introduction TG mismatched base pairs in DNA are responsible for most of the common mutations leading to formation of tumors in humans. TG mismatches are particularly abundant in cells lacking mismatch repair mechanism (MMR). MMR deficiency increases 50-1000-fold spontaneous mutation rates (microsatellite instability MSI). An increase of MSI is observed in hereditary nonpolyposis colon cancer (HNPCC) and in a series of sporadic tumor types. In addition, MMR deficiency can lead to resistance to several chemotherapeutic agents (DNA damaging agent). The aim of the present work is the development and validation of an ESI-MS screening method for the identification of new molecules able to recognize TG mismatched base pairs in DNA. Method ESI MS spectra were recorded on a Waters Q-Tof Ultima mass spectrometer with negative ion detection. Ions were generated under the following conditions: ESI sprayer voltage 2.0 kV, desolvation temperature 150°C, source block temperature 70°C, cone voltage 50V, and collision energy 5V. Samples were analyzed by continuous infusion at 5 uL/min. The acquired mass range was 500-2000 Da with a scan time set to 2 s. Different self complementary DNA sequence were synthesized. The duplex fully matched sequence was formed from the single strand d(GAACCGGTTC) and was used as control. A duplex DNA structure incorporating two T:G mismatched base pairs were obtained from the sequence d(GAACTGGTTC). Solutions of oligonucleotides were heated to 90°C for 5 min to form duplexes. Preliminary result Different papers confirm that the duplex DNA structure is maintained in the gas phase and the Watson-Crick base pairing is preserved [1,2]. In our study the formation of duplexes was confirmed by ESI-MS and dissociation curves were obtained for the different oligonucleotides confirming a decreasing stability of the duplexes when TG mismatches are present. Since a tandem T:G/G:T mismatch is seldom found in vivo, an hairpin DNA sequence d(GAACTGGTCCTCTGACTGGTTC) bearing a single T:G mismatch was prepared. This hairpin DNA was used to set up the method for studying the complexes formed with minor groove binders (distamycin A, Hoechst 33258, Hoechst 33342, DAPI) and intercalators (doxorubicin). One of the first investigated conditions was the concentration of ammonium acetate buffer. In the spectra obtained for the interaction between the hairpin (single mismatch) and distamycin A; both 1:1 and 1:2 drug-DNA complexes are present. A dependence of the buffer concentration on the binding was evidenced with an appreciable reduction of the distamycin adduct intensity at higher ammonium acetate concentration, moving from 20 to 100 mM. The dissociation constant of the complexof DNA hairpin and distamycin A was determined by holding the oligonucleotide concentration at 10 uM and titrating with distamycin A. The Kd values were calculated directly from the MS spectra intensities at different concentration. The obtained average value (K=[K1*K2]1/2) of 61 uM is in agreement with the 83 uM obtained by Surface Plasmon Resonance [3]. Experiments on imidazole analogs of distamycin, demonstrated to be selective for TG base pair [3] by mean of other techniques (SPR, NMR) are now ongoing. [1] Schnier, PD; Klassen, JS; Strittmatter, EF; Williams, ER; J. Am. Chem. Soc. 120 (1998) 9605[2] Gabelica, V; De Pauw, E; Int. J. Mass Spectrom 219 (2002) 151[3] Lacy, ER; Cox, KK; Wilson, WD; Lee, M; Nucleic Acid Res 30/8 (2002) 1834 Novel Aspect Application of ESI-MS to the study of TG mismatched DNA and development of screening methods for identifying selective ligands.
Tipologia IRIS:
14 - Intervento a convegno non pubblicato
Elenco autori:
F. Riccardi Sirtori, R. D’Alessio, G. Aldini, M. Colombo
Autori di Ateneo:
ALDINI GIANCARLO ( autore )
Link alla scheda completa:
https://air.unimi.it/handle/2434/60451
  • Aree Di Ricerca

Aree Di Ricerca

Settori


Settore CHIM/08 - Chimica Farmaceutica
  • Informazioni
  • Assistenza
  • Accessibilità
  • Privacy
  • Utilizzo dei cookie
  • Note legali

Realizzato con VIVO | Progettato da Cineca | 26.4.5.0